Stem-loop sequence cte-mir-219

AccessionMI0010099 (change log)
Previous IDscap-mir-219
DescriptionCapitella teleta miR-219 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   -----cagaca     -    c      u    a      a      uucacu 
5'            gucuu uuag auugau gucc aacgca uucuug      u
              ||||| |||| |||||| |||| |||||| ||||||       
3'            cggaa gauc uaacua cagg uugugu aagaac      c
   ccaacacauga     c    c      -    c      c      cucuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB301066.1: 18963-19063 [+]
intergenic
Database links

Mature sequence cte-miR-219

Accession MIMAT0009556
Previous IDscap-miR-219
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Evidence by similarity; MI0000358

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).