Stem-loop sequence cte-mir-33

AccessionMI0010096 (change log)
Previous IDscap-mir-33
DescriptionCapitella teleta miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   --------   aua    uug         -         uu         -  aag 
5'         gga   cgcu   cacauuggu gcauuguag  gcauugcau gg   u
           |||   ||||   ||||||||| |||||||||  ||||||||| ||    
3'         ccu   gcgg   guguaacua cgugacguc  cgugacgug cc   u
   accaucau   ---    --a         a         cu         g  aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB311953.1: 237747-237847 [-]
intergenic
Database links

Mature sequence cte-miR-33

Accession MIMAT0009553
Previous IDscap-miR-33
Sequence

21 - 

gugcauuguaguugcauugca

 - 41

Get sequence
Evidence by similarity; MI0000364

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).