Stem-loop sequence cte-bantam

AccessionMI0010094 (change log)
Previous IDscap-bantam
DescriptionCapitella teleta bantam stem-loop
Gene family MIPF0000153; bantam
Stem-loop
   uca a  --aagacuu      c        u uu      uc    u   u 
5'    g gc         gcgaga ugguuuuc c  uggucu  caga uuu a
      | ||         |||||| |||||||| |  ||||||  |||| ||| u
3'    c cg         cgcucu aucaaaag g  acuaga  gucu aag u
   -ga -  cauuacagu      a        u uu      --    u   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB292771.1: 319143-319243 [+]
intergenic
Database links

Mature sequence cte-bantam

Accession MIMAT0009551
Previous IDscap-bantam
Sequence

61 - 

ugagaucauugugaaaacuaauc

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).