Stem-loop sequence cte-mir-279

AccessionMI0010083 (change log)
Previous IDscap-mir-279
DescriptionCapitella teleta miR-279 stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   ----c   uc       c    a   gc        a    c   u   gau 
5'      guu  gcugucg cuug aug  uguggauc aguc aug uaa   u
        |||  ||||||| |||| |||  |||||||| |||| ||| |||   u
3'      cga  cggcggu ggac uac  acaccuag ucag uac guu   c
   cuucc   -u       u    c   uc        a    -   u   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB297234.1: 703501-703601 [-]
intergenic
Clustered miRNAs
< 10kb from cte-mir-279
cte-mir-279KB297234.1: 703501-703601 [-]
cte-mir-36KB297234.1: 701715-701805 [-]
Database links

Mature sequence cte-miR-279

Accession MIMAT0009539
Previous IDscap-miR-279
Sequence

61 - 

ugacuagauccacacucaucc

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).