Stem-loop sequence cte-mir-184a

AccessionMI0010074 (change log)
Previous IDscap-mir-184a
DescriptionCapitella teleta miR-184a stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   cauca    --a   -    au      c  u             ccgu   a 
5'      cucg   ucg cacg  uccuua ca uucuuuguccggu    gug u
        ||||   ||| ||||  |||||| || |||||||||||||    ||| u
3'      gagc   agc gugu  gggaau gu aagaggcagguca    uac a
   --ucc    acc   a    cc      a  c             ---c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB301807.1: 120185-120285 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-184a
cte-mir-184aKB301807.1: 120185-120285 [+]
cte-mir-184bKB301807.1: 120358-120452 [+]
Database links

Mature sequence cte-miR-184a

Accession MIMAT0009530
Previous IDscap-miR-184a
Sequence

61 - 

uggacggagaacugauaagggc

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).