Stem-loop sequence cte-mir-29b

Accession MI0010058
Previous IDs cap-mir-29b
Description Capitella teleta miR-29b stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--    -   c  c  -     c   c      ga     -----u    uu 
  ggag gcu gg gc cuggu uca auggug  uagag      uggc  c
  |||| ||| || || ||||| ||| ||||||  |||||      ||||   
  ccuc cgg cu cg gacua agu uaccac  auuuc      accg  g
cu    u   u  u  u     a   u      -g     caaguu    cg 
Get sequence
Deep sequencing
128 reads, 1 experiments
Genome context
Coordinates (JGI1.0) Overlapping transcripts
scaffold_794: 7583-7678 [-]
intergenic
Clustered miRNAs
< 10kb from cte-mir-29b
cte-mir-29b scaffold_794: 7583-7678 [-]
cte-mir-29a scaffold_794: 6875-6970 [-]

Mature sequence cte-miR-29b

Accession MIMAT0009514
Previous IDs cap-miR-29b
Sequence

61 - 

uagcaccauuugaaaucagug

 - 81

Get sequence
Deep sequencing 128 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).