Stem-loop sequence cte-mir-8

AccessionMI0010051 (change log)
Previous IDscap-mir-8
DescriptionCapitella teleta miR-8 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   gccagcc c        ug        -   c     c      -uu  c 
5'        g ggguugug  gacaucuu acc ggcgg auuaga   ga c
          | ||||||||  |||||||| ||| ||||| ||||||   || g
3'        c cucagcac  cuguagaa ugg cuguc uaaucu   cu g
   --cugua -        cu        a   a     a      ucu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB309117.1: 60503-60600 [+]
intergenic
Database links

Mature sequence cte-miR-8

Accession MIMAT0009507
Previous IDscap-miR-8
Sequence

60 - 

uaauacugucagguaaagauguc

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).