Stem-loop sequence cte-mir-7

AccessionMI0010050 (change log)
Previous IDscap-mir-7
DescriptionCapitella teleta miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   --uaacccu    uu         -     cua       u      -uau a 
5'          cugu  caugaugug gaaga   gugauuu auuguu    g a
            ||||  ||||||||| |||||   ||||||| ||||||    |  
3'          gaca  guacuacac cuucu   cacuaaa uaacaa    c a
   aacauucau    -u         u     -ca       -      ccgu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB311498.1: 61636-61736 [+]
intergenic
Database links

Mature sequence cte-miR-7

Accession MIMAT0009506
Previous IDscap-miR-7
Sequence

21 - 

uggaagacuagugauuuuauuguu

 - 44

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).