Stem-loop sequence cte-mir-2c

Accession MI0010049
Previous IDs cap-mir-2c
Description Capitella teleta miR-2c stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u ug  uuu     u a     c        -      g   u    uuuu 
 g  uu   ggguu g ucggc uaucaagg uggcug gau uggg    u
 |  ||   ||||| | ||||| |||||||| |||||| ||| ||||     
 c  ga   uccag c aguug auaguuuc accgac cua accc    a
g gu  -cu     u -     a        g      a   u    cguu 
Get sequence
Deep sequencing
3 reads, 1 experiments
Genome context
Coordinates (JGI1.0) Overlapping transcripts
scaffold_933: 10390-10490 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2c
cte-mir-71 scaffold_933: 9913-10013 [+]
cte-mir-2b scaffold_933: 10029-10129 [+]
cte-mir-2g scaffold_933: 10157-10241 [+]
cte-mir-2c scaffold_933: 10390-10490 [+]
cte-mir-2a scaffold_933: 10534-10634 [+]

Mature sequence cte-miR-2c

Accession MIMAT0009505
Previous IDs cap-miR-2c
Sequence

61 - 

uaucacagccagcuuugauaag

 - 82

Get sequence
Deep sequencing 3 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).