Stem-loop sequence cte-mir-2c

AccessionMI0010049 (change log)
Previous IDscap-mir-2c
DescriptionCapitella teleta miR-2c stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   u ug  uuu     u a     c        -      g   u    uuuu 
5'  g  uu   ggguu g ucggc uaucaagg uggcug gau uggg    u
    |  ||   ||||| | ||||| |||||||| |||||| ||| ||||     
3'  c  ga   uccag c aguug auaguuuc accgac cua accc    a
   g gu  -cu     u -     a        g      a   u    cguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB312122.1: 10390-10490 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2c
cte-mir-71KB312122.1: 9913-10013 [+]
cte-mir-2bKB312122.1: 10029-10129 [+]
cte-mir-2gKB312122.1: 10157-10241 [+]
cte-mir-2cKB312122.1: 10390-10490 [+]
cte-mir-2aKB312122.1: 10534-10634 [+]
Database links

Mature sequence cte-miR-2c

Accession MIMAT0009505
Previous IDscap-miR-2c
Sequence

61 - 

uaucacagccagcuuugauaag

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).