Stem-loop sequence cte-mir-2b

AccessionMI0010048 (change log)
Previous IDscap-mir-2b
DescriptionCapitella teleta miR-2b stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   --ucgug       ugu   --     u      augucauaguccccugu 
5'        accucug   ggc  gucaa guuggu                 g
          |||||||   |||  ||||| ||||||                 a
3'        uggagac   ccg  uaguu caaccg                 c
   cucucua       uuu   ag     c      acacuaucccggaugcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB312122.1: 10029-10129 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2b
cte-mir-71KB312122.1: 9913-10013 [+]
cte-mir-2bKB312122.1: 10029-10129 [+]
cte-mir-2gKB312122.1: 10157-10241 [+]
cte-mir-2cKB312122.1: 10390-10490 [+]
cte-mir-2aKB312122.1: 10534-10634 [+]
Database links

Mature sequence cte-miR-2b

Accession MIMAT0009504
Previous IDscap-miR-2b
Sequence

63 - 

ucacagccaaccuugaugagcc

 - 84

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).