Stem-loop sequence cte-mir-2a

AccessionMI0010047 (change log)
Previous IDscap-mir-2a
DescriptionCapitella teleta miR-2a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   -------------  a   ac           -   c      uucucuuccuccuc    a 
5'              gg gga  cgacaaagugg cug gaugug              cgau u
                || |||  ||||||||||| ||| ||||||              ||||  
3'              cc ucu  guuguuucgcc gac cuauac              gcug g
   cucucauaacgug  g   ca           c   a      -----------cac    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB312122.1: 10534-10634 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2a
cte-mir-71KB312122.1: 9913-10013 [+]
cte-mir-2bKB312122.1: 10029-10129 [+]
cte-mir-2gKB312122.1: 10157-10241 [+]
cte-mir-2cKB312122.1: 10390-10490 [+]
cte-mir-2aKB312122.1: 10534-10634 [+]
Database links

Mature sequence cte-miR-2a

Accession MIMAT0009503
Previous IDscap-miR-2a
Sequence

61 - 

uaucacagcccgcuuuguugacu

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).