Stem-loop sequence cte-mir-1

AccessionMI0010046 (change log)
Previous IDscap-mir-1
DescriptionCapitella teleta miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   accg     c  u   g         c     acg     uuuc   ua 
5'     gcgug ga ugu acauacuuc uuaca   ccaua    cca  u
       ||||| || ||| ||||||||| |||||   |||||    |||   
3'     cguac cu acg uguaugaag aaugu   gguau    ggu  u
   -uca     c  u   a         a     -aa     ----   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB301107.1: 105938-106031 [-]
intergenic
Clustered miRNAs
< 10kb from cte-mir-1
cte-mir-1KB301107.1: 105938-106031 [-]
cte-mir-133KB301107.1: 99075-99175 [-]
Database links

Mature sequence cte-miR-1

Accession MIMAT0009502
Previous IDscap-miR-1
Sequence

59 - 

uggaauguaaagaaguauguag

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).