Stem-loop sequence bfl-mir-281

AccessionMI0010044 (change log)
DescriptionBranchiostoma floridae miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   cuauuucccucugu              cg         u   gaa c 
5'               gcggaggggagagc  uuccgugac gug   c u
                 ||||||||||||||  ||||||||| |||   |  
3'               cgccuuuucucucg  gagguacug cac   g c
   -------------g              uu         u   aag g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666567.1: 904339-904423 [+]
intergenic
Database links

Mature sequence bfl-miR-281

Accession MIMAT0009500
Sequence

59 - 

ugucauggaguugcucucuuuu

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).