Stem-loop sequence bfl-mir-210

AccessionMI0010038 (change log)
DescriptionBranchiostoma floridae miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   ---acag          g    c   u     u        a  u  --   g 
5'        uuggucggug cauu gcc cuguu cgcgcgca ga gu  gau u
          |||||||||| |||| ||| ||||| |||||||| || ||  |||  
3'        aaccggccac guag cgg gacag gugcgugu cu cg  cug u
   gcugcaa          -    u   c     u        c  -  uc   a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666487.1: 678318-678418 [-]
intergenic
Database links

Mature sequence bfl-miR-210-5p

Accession MIMAT0019149
Previous IDsbfl-miR-210*
Sequence

20 - 

cgccucuguuucgcgcgcaaga

 - 41

Get sequence
Evidence experimental; 454 [2]

Mature sequence bfl-miR-210-3p

Accession MIMAT0009494
Previous IDsbfl-miR-210
Sequence

61 - 

cugugcgugugacagcggcuga

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).