Stem-loop sequence bfl-mir-124

Accession

MI0010026

Description

Branchiostoma floridae miR-124 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

cggcaaaucuc    ug c    a        g   gu        ua    
           ggcu  g ucuu guguucac gcg  ccuuaauu  aca 
           ||||  | |||| |||||||| |||  ||||||||  || u
           ccgg  c agaa cguaagug cgc  ggaauuaa  ugu 
--acuccuaaa    ga a    c        g   ac        cg    

Deep sequencing

17 reads, 1 experiments

Genome context

• Coordinates (JGI2.0): Bf_V2_32: 1879911-1880011 [+]
• Overlapping transcripts:

  intergenic

Mature sequence bfl-miR-124-5p

• Accession: MIMAT0019146
• Previous IDs: bfl-miR-124*
• Sequence: 24 - aguguucacggcgguccuuaau - 45
• Deep sequencing: 8 reads, 1 experiments
• Evidence: experimental; 454 [2]

Mature sequence bfl-miR-124-3p

• Accession: MIMAT0009482
• Previous IDs: bfl-miR-124
• Sequence: 61 - uaaggcacgcggugaaugccaa - 82
• Deep sequencing: 9 reads, 1 experiments
• Evidence: experimental; 454 [1]

References

1. PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2. PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).