Stem-loop sequence bfl-mir-96

AccessionMI0010024 (change log)
DescriptionBranchiostoma floridae miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   --ccug  -u     uu   c               c     u   gg   g 
5'       cc  cuuuc  gcu uguuuggcacuagca auuuu gcu  gca g
         ||  |||||  ||| ||||||||||||||| ||||| |||  |||  
3'       gg  gaaag  cga auaaaccgugauugu uaaaa cgg  ugu u
   cauuca  cc     uc   c               -     c   -a   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666602.1: 1109798-1109898 [+]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-96
bfl-mir-183GG666602.1: 1108717-1108817 [+]
bfl-mir-96GG666602.1: 1109798-1109898 [+]
Database links

Mature sequence bfl-miR-96-5p

Accession MIMAT0009480
Previous IDsbfl-miR-96
Sequence

21 - 

uuuggcacuagcacauuuuugcu

 - 43

Get sequence
Evidence experimental; 454 [1]

Mature sequence bfl-miR-96-3p

Accession MIMAT0019144
Previous IDsbfl-miR-96*
Sequence

59 - 

ccaaaauuguuagugccaaau

 - 79

Get sequence
Evidence experimental; 454 [2]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).