Stem-loop sequence bfl-mir-34a

AccessionMI0010019 (change log)
Previous IDsbfl-mir-34
DescriptionBranchiostoma floridae miR-34a stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   ------ugguuac          c     c      g    c    c   ucu 
5'              cuguguguug ugugg agugug auag uggc guu   a
                |||||||||| ||||| |||||| |||| |||| |||    
3'              ggcacacaau augcc ucacac uguc accg caa   a
   ggcacaacauuca          a     c      a    -    a   uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666685.1: 1087742-1087842 [-]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-34a
bfl-mir-34c-1GG666685.1: 1088499-1088590 [-]
bfl-mir-34aGG666685.1: 1087742-1087842 [-]
bfl-mir-34dGG666685.1: 1086839-1086926 [-]
Database links

Mature sequence bfl-miR-34a

Accession MIMAT0009475
Previous IDsbfl-miR-34
Sequence

21 - 

uggcaguguggauagcuggccguuu

 - 45

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).