Stem-loop sequence bfl-mir-33-2

AccessionMI0010018 (change log)
DescriptionBranchiostoma floridae miR-33-2 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   aca     ug  a   -                     gug aa 
5'    ccugu  cu ggg ugcauuguaguugcauugcau   c  c
      |||||  || ||| |||||||||||||||||||||   |   
3'    ggacg  ga ccc acgugacgucaauguaacgug   g  a
   caa     ga  -   g                     -aa ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666471.1: 4947944-4948030 [-]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-33-2
bfl-mir-33-2GG666471.1: 4947944-4948030 [-]
bfl-mir-33-1GG666471.1: 4947531-4947612 [-]
Database links

Mature sequence bfl-miR-33

Accession MIMAT0009474
Sequence

16 - 

gugcauuguaguugcauugcau

 - 37

Get sequence
Evidence experimental; 454 [1], cloned [2]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2