Stem-loop sequence bfl-mir-7

AccessionMI0010009 (change log)
DescriptionBranchiostoma floridae miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   -    u     u        a       ugu      g  u 
5'  gugu cugua ggaagacu gugauuu   uguugu ug c
    |||| ||||| |||||||| |||||||   |||||| || u
3'  uacg ggcau ccuucuga cacuaaa   acaaca ac u
   c    u     u        -       -ug      a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666535.1: 1621042-1621123 [-]
intergenic
Database links

Mature sequence bfl-miR-7

Accession MIMAT0009464
Sequence

11 - 

uggaagacuagugauuuuguugu

 - 33

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).