Stem-loop sequence bmo-mir-278

AccessionMI0010006 (change log)
DescriptionBombyx mori miR-278 stem-loop
Gene family MIPF0000155; mir-278
Literature search

5 open access papers mention bmo-mir-278
(16 sentences)

Stem-loop
       c     c    cc        cu     g u     gaca 
5' guau aagug uacg  cggacgaa  uccca c cggcc    a
   |||| ||||| ||||  ||||||||  ||||| | |||||     
3' caua uucgc augu  gccugcuu  agggu g gcugg    u
       -     u    uu        cu     - -     ggac 
Get sequence
Deep sequencing
13409 reads, 2.13e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582026.1: 5082537-5082623 [+]
intergenic
Database links

Mature sequence bmo-miR-278-5p

Accession MIMAT0015291
Previous IDsbmo-miR-278*
Sequence

17 - 

ccggacgaacuucccagcucgg

 - 38

Get sequence
Deep sequencing4616 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-278-3p

Accession MIMAT0009164
Previous IDsbmo-miR-278
Sequence

53 - 

ucggugggaucuucguccguuu

 - 74

Get sequence
Deep sequencing8792 reads, 3 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).