Stem-loop sequence bmo-mir-9b

AccessionMI0010004 (change log)
DescriptionBombyx mori miR-9b stem-loop
Gene family MIPF0000014; mir-9
Literature search

5 open access papers mention bmo-mir-9b
(15 sentences)

Stem-loop
   -gac      ac            ua  c      ua   a  ga 
5'     ggcgcg  gcgaugcuuugg  au uagcuu  uga cg  a
       ||||||  ||||||||||||  || ||||||  ||| ||   
3'     ccgcgc  cgcugcgaaacc  ua aucgag  acu gu  u
   cggc      ga            gc  a      gc   -  ag 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581774.1: 31448-31537 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-9b
bmo-mir-9bNW_004581774.1: 31448-31537 [-]
bmo-mir-79NW_004581774.1: 31444-31543 [+]
bmo-mir-306bNW_004581774.1: 30994-31069 [-]
bmo-mir-306aNW_004581774.1: 30978-31085 [+]
bmo-mir-9cNW_004581774.1: 28981-29088 [+]
Database links

Mature sequence bmo-miR-9b-5p

Accession MIMAT0009161
Previous IDsbmo-miR-9b
Sequence

17 - 

gcuuugguaaucuagcuuuauga

 - 39

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence bmo-miR-9b-3p

Accession MIMAT0015290
Previous IDsbmo-miR-9b*
Sequence

53 - 

acggagcuaaaucgccaaagcg

 - 74

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).