Stem-loop sequence bmo-mir-9b

AccessionMI0010004
DescriptionBombyx mori miR-9b stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -gac      ac            ua  c      ua   a  ga 
5'     ggcgcg  gcgaugcuuugg  au uagcuu  uga cg  a
       ||||||  ||||||||||||  || ||||||  ||| ||   
3'     ccgcgc  cgcugcgaaacc  ua aucgag  acu gu  u
   cggc      ga            gc  a      gc   -  ag 
Get sequence
Deep sequencing
2 reads, 1.64 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2839: 31358-31447 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-9b
bmo-mir-9bnscaf2839: 31358-31447 [-]
bmo-mir-79nscaf2839: 31354-31453 [+]
bmo-mir-306bnscaf2839: 30904-30979 [-]
bmo-mir-306anscaf2839: 30888-30995 [+]
bmo-mir-9cnscaf2839: 28891-28998 [+]

Mature sequence bmo-miR-9b-5p

Accession MIMAT0009161
Previous IDsbmo-miR-9b
Sequence

17 - 

gcuuugguaaucuagcuuuauga

 - 39

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bmo-miR-9b-3p

Accession MIMAT0015290
Previous IDsbmo-miR-9b*
Sequence

53 - 

acggagcuaaaucgccaaagcg

 - 74

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).