Stem-loop sequence bmo-mir-932

AccessionMI0010003
DescriptionBombyx mori miR-932 stem-loop
Gene family MIPF0000588; mir-932
Stem-loop
   -----------     ga       a       g   a      --u  a 
5'            guguu  ggcuuca uuccgua ugc uugcag   gc u
              |||||  ||||||| ||||||| ||| ||||||   || g
3'            uacgg  ucggagu agggcgu acg aacguc   cg c
   caucaauuccg     ag       g       g   -      cac  u 
Get sequence
Deep sequencing
1 reads, 0.682 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2847: 7595334-7595422 [+]
intergenic

Mature sequence bmo-miR-932

Accession MIMAT0009160
Sequence

12 - 

ucaauuccguagugcauugcag

 - 33

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).