Dead miRNA entry

miRNA accession:
MI0010002
miRNA ID:
bmo-mir-930
Comment:
Bombyx miR-930 appears to be a misannotated fragment of a homeobox gene (Peterson K, pers. comm.), so is removed from the database.

Previous miRNA entry

Stem-loop sequence bmo-mir-930

AccessionMI0010002 (change log)
DescriptionBombyx mori miR-930 stem-loop
Stem-loop
   gcuuacaucucaccgagacucagguaaaga        cagaaccgacguaacaag 
5'                               ucugguuc                  u
                                 ||||||||                  g
3'                               agaucgag                  g
   ---------------------------cga        ucgucgauugacggagaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links