Stem-loop sequence bmo-mir-929

AccessionMI0010001
DescriptionBombyx mori miR-929 stem-loop
Gene family MIPF0000447; mir-929
Stem-loop
   --------------------u     a       uag         -  u 
5'                      guuaa uugacuc   uagggaguc cg u
                        ||||| |||||||   ||||||||| || c
3'                      caguu gacugag   aucccucag gc c
   gcagcuaaaucguaguuucuu     g       cua         c  g 
Get sequence
Deep sequencing
7 reads, 3.39 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf3003: 395214-395295 [+]
intergenic

Mature sequence bmo-miR-929-5p

Accession MIMAT0009158
Previous IDsbmo-miR-929
Sequence

7 - 

auugacucuaguagggagucc

 - 27

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence bmo-miR-929-3p

Accession MIMAT0015289
Previous IDsbmo-miR-929*
Sequence

39 - 

cucccuaaucgagucagguuga

 - 60

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).