Stem-loop sequence bmo-mir-927

AccessionMI0010000
DescriptionBombyx mori miR-927 stem-loop
Gene family MIPF0000452; mir-927
Stem-loop
   -u    ccu     c          cu       a  guu  ca 
5'   gcag   uuuug uuuagaauuc  acgcuuu cc   gc  a
     ||||   ||||| ||||||||||  ||||||| ||   ||   
3'   cguc   aaagc aaaucuuagg  ugcgaaa gg   ug  g
   ac    aau     a          uu       c  -gu  au 
Get sequence
Deep sequencing
309 reads, 75.1 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2575: 1011451-1011538 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-927
bmo-mir-1926nscaf2575: 1011450-1011539 [-]
bmo-mir-927nscaf2575: 1011451-1011538 [+]

Mature sequence bmo-miR-927-5p

Accession MIMAT0009157
Previous IDsbmo-miR-927
Sequence

15 - 

uuuagaauuccuacgcuuuacc

 - 36

Get sequence
Deep sequencing225 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence bmo-miR-927-3p

Accession MIMAT0015288
Previous IDsbmo-miR-927*
Sequence

54 - 

caaagcguuuggauucuaa

 - 72

Get sequence
Deep sequencing52 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).