Stem-loop sequence bmo-mir-927

AccessionMI0010000 (change log)
DescriptionBombyx mori miR-927 stem-loop
Gene family MIPF0000452; mir-927
Stem-loop
   -u    ccu     c          cu       a  guu  ca 
5'   gcag   uuuug uuuagaauuc  acgcuuu cc   gc  a
     ||||   ||||| ||||||||||  ||||||| ||   ||   
3'   cguc   aaagc aaaucuuagg  ugcgaaa gg   ug  g
   ac    aau     a          uu       c  -gu  au 
Get sequence
Deep sequencing
315 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581679.1: 1013971-1014058 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-927
bmo-mir-1926NW_004581679.1: 1013970-1014059 [-]
bmo-mir-927NW_004581679.1: 1013971-1014058 [+]
Database links

Mature sequence bmo-miR-927-5p

Accession MIMAT0009157
Previous IDsbmo-miR-927
Sequence

15 - 

uuuagaauuccuacgcuuuacc

 - 36

Get sequence
Deep sequencing257 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-927-3p

Accession MIMAT0015288
Previous IDsbmo-miR-927*
Sequence

54 - 

caaagcguuuggauucuaa

 - 72

Get sequence
Deep sequencing58 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).