Dead miRNA entry

miRNA accession:
MI0009999
miRNA ID:
bmo-mir-925
Forward to:
MI0005746
Comment:
miR-925 appears to be a misannotated fragment HRNBP1 coding seqeunce (Peterson K, pers. comm.), so is removed from the database.

Previous miRNA entry

Stem-loop sequence bmo-mir-925

AccessionMI0009999 (change log)
DescriptionBombyx mori miR-925 stem-loop
Stem-loop
   --------------------    c    uuu  aa       uuu u 
5'                     gcga gcug   uu  ugcaugu   g c
                       |||| ||||   ||  |||||||   | u
3'                     uguu uggc   ag  acguacg   c g
   guggugauaaacgcuuacaa    u    -uu  gg       -uu u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links