Stem-loop sequence bmo-mir-137

AccessionMI0009995 (change log)
DescriptionBombyx mori miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

3 open access papers mention bmo-mir-137
(3 sentences)

Stem-loop
   uaac  -g    ga  uc   c       ug  g   u    - aua 
5'     ac  cuug  gg  acg guauucu  gg aau aaca c   u
       ||  ||||  ||  ||| |||||||  || ||| |||| |    
3'     ug  gaac  uc  ugc cauaaga  uc uua uugu g   g
   ---a  ag    ag  ga   a       gu  g   -    a agu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582035.1: 1646055-1646144 [-]
intergenic
Database links

Mature sequence bmo-miR-137

Accession MIMAT0009152
Sequence

55 - 

uuauugcuugagaauacacgua

 - 76

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).