Stem-loop sequence bmo-mir-12

AccessionMI0009994 (change log)
DescriptionBombyx mori miR-12 stem-loop
Literature search

3 open access papers mention bmo-mir-12
(3 sentences)

Stem-loop
   ------u    -      a  -uc   ua   -    uauuaaauaaaa 
5'        ucug aguauu cu   agg  cug guug            a
          |||| |||||| ||   |||  ||| ||||            a
3'        aggc uuauag ga   ucc  gac caau            c
   agcauuu    a      a  uaa   --   a    uauugaauaagg 
Get sequence
Deep sequencing
7900 reads, 1.23e+03 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581701.1: 690490-690579 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-12
bmo-mir-283NW_004581701.1: 692153-692235 [-]
bmo-mir-12NW_004581701.1: 690490-690579 [-]
Database links

Mature sequence bmo-miR-12

Accession MIMAT0009151
Sequence

4 - 

ugaguauuacuucagguacuggu

 - 26

Get sequence
Deep sequencing7900 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).