Stem-loop sequence mmu-mir-1982

AccessionMI0009993 (change log)
Symbol MGI:Mir1982
DescriptionMus musculus miR-1982 stem-loop
Stem-loop
   guugguauugcu      gg ccu   -      aguuc   c 
5'             ugggag  u   ggg gagggg     ugg a
               ||||||  |   ||| ||||||     |||  
3'             acccuc  g   ccc cucucc     acc c
   ---------gac      uu uau   a      ----a   c 
Get sequence
Deep sequencing
248 reads, 1.61 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 80828797-80828870 [+]
sense
OTTMUST00000111591 ; Oaz1-002; exon 2
OTTMUST00000111596 ; Oaz1-006; intron 2
OTTMUST00000111595 ; Oaz1-004; intron 4
OTTMUST00000111592 ; Oaz1-003; intron 5
OTTMUST00000111593 ; Oaz1-001; intron 5
OTTMUST00000111594 ; Oaz1-005; intron 5
ENSMUST00000179894 ; Oaz1-002; exon 2
ENSMUST00000179341 ; Oaz1-006; intron 2
ENSMUST00000179620 ; Oaz1-004; intron 4
ENSMUST00000177850 ; Oaz1-003; intron 5
ENSMUST00000180036 ; Oaz1-001; intron 5
ENSMUST00000179172 ; Oaz1-005; intron 5
ENSMUST00000060987 ; Oaz1-201; intron 5
Database links

Mature sequence mmu-miR-1982-5p

Accession MIMAT0009459
Previous IDsmmu-miR-1982*
Sequence

12 - 

uugggaggguccuggggagg

 - 31

Get sequence
Deep sequencing20 reads, 16 experiments
Evidence experimental; Illumina [1-3]
Predicted targets

Mature sequence mmu-miR-1982-3p

Accession MIMAT0009460
Previous IDsmmu-miR-1982.1
Sequence

52 - 

ucucacccuauguucucccacag

 - 74

Get sequence
Deep sequencing225 reads, 53 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:18923076 "Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs" Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R Genes Dev. 22:2773-2785(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).