Stem-loop sequence mmu-mir-1981

AccessionMI0009992 (change log)
Symbol MGI:Mir1981
DescriptionMus musculus miR-1981 stem-loop
Stem-loop
   ---g       ug  c     cg    cu   g ug     u 
5'     uaaaggc  gg uuaga  uggc  uug g  uggaa g
       |||||||  || |||||  ||||  ||| |  ||||| c
3'     guuuccg  cc aaucu  accg  aau u  gccuu a
   gaca       gu  c     --    cc   g uu     c 
Get sequence
Deep sequencing
90684 reads, 225 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 184822407-184822488 [-]
sense
OTTMUST00000088664 ; Mosc2-009; intron 1
OTTMUST00000088661 ; Mosc2-006; intron 2
OTTMUST00000088662 ; Mosc2-007; intron 2
OTTMUST00000088663 ; Mosc2-008; intron 2
OTTMUST00000088659 ; Mosc2-004; intron 4
OTTMUST00000088656 ; Mosc2-001; intron 5
OTTMUST00000088658 ; Mosc2-003; intron 5
ENSMUST00000161341 ; Marc2-009; intron 1
ENSMUST00000161359 ; Marc2-006; intron 2
ENSMUST00000162261 ; Marc2-008; intron 2
ENSMUST00000162866 ; Marc2-007; intron 2
ENSMUST00000159293 ; Marc2-004; intron 4
ENSMUST00000068725 ; Marc2-001; intron 5
ENSMUST00000161821 ; Marc2-003; intron 5
Database links

Mature sequence mmu-miR-1981-5p

Accession MIMAT0009458
Previous IDsmmu-miR-1981
Sequence

1 - 

guaaaggcugggcuuagacguggc

 - 24

Get sequence
Deep sequencing89652 reads, 75 experiments
Evidence experimental; Illumina [1,3]
Database links
Predicted targets

Mature sequence mmu-miR-1981-3p

Accession MIMAT0017351
Previous IDsmmu-miR-1981*
Sequence

60 - 

caucuaacccuggccuuugac

 - 80

Get sequence
Deep sequencing1030 reads, 73 experiments
Evidence experimental; 454 [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:18923076 "Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs" Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R Genes Dev. 22:2773-2785(2008).
2
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).