Stem-loop sequence mmu-mir-1839

AccessionMI0009991 (change log)
Symbol MGI:Mir1839
DescriptionMus musculus miR-1839 stem-loop
Gene family MIPF0000702; mir-1839
Literature search

5 open access papers mention mmu-mir-1839
(17 sentences)

Stem-loop
   ---------gaaaa         aac        uu gca 
5'               gguagauag   aggucuug  u   a
                 |||||||||   ||||||||  |   a
3'               ccaucuauu   uccagaac  a   a
   uccguuaccgacaa         -ca        uu aau 
Get sequence
Deep sequencing
1214067 reads, 2.23e+03 reads per million, 109 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named mmu-mir-1980 in [1], but is a clear ortholog of the mir-1839 sequence published in dog (MI0008087), so is renamed here.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 81529916-81529988 [+]
sense
OTTMUST00000112761 ; WI1-1616M8.2-004; exon 2
OTTMUST00000112763 ; WI1-1616M8.2-003; intron 3
OTTMUST00000112767 ; WI1-1616M8.2-001; intron 3
ENSMUST00000175366 ; Mir1839-201; exon 1
ENSMUST00000180385 ; 2900076A07Rik-004; exon 2
ENSMUST00000181492 ; 2900076A07Rik-001; intron 3
ENSMUST00000180879 ; 2900076A07Rik-003; intron 3
Database links

Mature sequence mmu-miR-1839-5p

Accession MIMAT0009456
Sequence

4 - 

aagguagauagaacaggucuug

 - 25

Get sequence
Deep sequencing1209914 reads, 109 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-1839-3p

Accession MIMAT0009457
Sequence

43 - 

agaccuacuuaucuaccaacagc

 - 65

Get sequence
Deep sequencing4149 reads, 102 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:18923076 "Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs" Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R Genes Dev. 22:2773-2785(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).