Stem-loop sequence mmu-mir-1839

Accession MI0009991
Symbol MGI:Mir1839
Description Mus musculus miR-1839 stem-loop
Gene family MIPF0000702; mir-1839
Stem-loop
---------gaaaa         aac        uu gca 
              gguagauag   aggucuug  u   a
              |||||||||   ||||||||  |   a
              ccaucuauu   uccagaac  a   a
uccguuaccgacaa         -ca        uu aau 
Get sequence
Deep sequencing
999306 reads, 3.21e+03 reads per million, 100 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named mmu-mir-1980 in [1], but is a clear ortholog of the mir-1839 sequence published in dog (MI0008087 ), so is renamed here.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr7: 81529916-81529988 [+]
sense
OTTMUST00000112761 ; WI1-1616M8.2-004; exon 2
OTTMUST00000112763 ; WI1-1616M8.2-003; intron 3
OTTMUST00000112767 ; WI1-1616M8.2-001; intron 3
ENSMUST00000175366 ; Mir1839-201; exon 1
ENSMUST00000180385 ; mmu-mir-1839.1-004; exon 2
ENSMUST00000180879 ; mmu-mir-1839.1-003; intron 3
ENSMUST00000181492 ; mmu-mir-1839.1-001; intron 3
Database links

Mature sequence mmu-miR-1839-5p

Accession MIMAT0009456
Sequence

4 - 

aagguagauagaacaggucuug

 - 25

Get sequence
Deep sequencing 974699 reads, 85 experiments
Evidence experimental; Solexa [18923076,20413612]
Predicted targets

Mature sequence mmu-miR-1839-3p

Accession MIMAT0009457
Sequence

43 - 

agaccuacuuaucuaccaacagc

 - 65

Get sequence
Deep sequencing 2728 reads, 80 experiments
Evidence experimental; Solexa [18923076,20413612]
Predicted targets

References

1
PMID:18923076 "Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs" Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R Genes Dev. 22:2773-2785(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).