Stem-loop sequence mmu-mir-1983

AccessionMI0009990 (change log)
Symbol MGI:Mir1983
DescriptionMus musculus miR-1983 stem-loop
Literature search

8 open access papers mention mmu-mir-1983
(13 sentences)

Stem-loop
   ---ccuuuaca                 ---u   --------    --     uag   g g    u     a 
5'            gagaaagcaugcuccag    ggc        gcaa  ucggu   cgc c guac uauac g
              |||||||||||||||||    |||        ||||  |||||   ||| | |||| |||||  
3'            uucuuuuguacgagguc    ccg        uguu  agccg   gug g cgug auaug c
   ccgccuuuccc                 cacu   agcuugag    gg     -ua   - g    u     a 
Get sequence
Deep sequencing
33124 reads, 64.5 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Babiarz et al. show that mir-1983 is derived from Dicer-dependent processing of an alternative hairpin conformation of a tRNA(Ile) sequence [1]. The biological significance of the mature miRNA is unknown, and tRNA-derived miRNA sequences are not expected to be prevalent.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 21896918-21897049 [-]
intergenic
Database links

Mature sequence mmu-miR-1983

Accession MIMAT0009455
Sequence

100 - 

cucaccuggagcauguuuucu

 - 120

Get sequence
Deep sequencing24216 reads, 101 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18923076 "Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs" Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R Genes Dev. 22:2773-2785(2008).