Stem-loop sequence hsa-mir-1976

Accession MI0009986
Symbol HGNC:MIR1976
Description Homo sapiens miR-1976 stem-loop
Gene family MIPF0001633; mir-1976
Stem-loop 
          a        uc uaa 
gcagcaagga ggcagggg  c   g
|||||||||| ||||||||  |    
ugucguuccu ccguccuc  g   g
          c        cu ugu
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 26881033-26881084 [+]
sense
OTTHUMT00000011433 ; RPS6KA1-003; intron 7
OTTHUMT00000390854 ; RPS6KA1-011; intron 7
OTTHUMT00000390856 ; RPS6KA1-008; intron 7
OTTHUMT00000011433 ; RPS6KA1-003; intron 7
OTTHUMT00000390854 ; RPS6KA1-011; intron 7
OTTHUMT00000390856 ; RPS6KA1-008; intron 7
OTTHUMT00000011433 ; RPS6KA1-003; intron 7
OTTHUMT00000390854 ; RPS6KA1-011; intron 7
OTTHUMT00000390856 ; RPS6KA1-008; intron 7
OTTHUMT00000011431 ; RPS6KA1-001; intron 8
OTTHUMT00000390850 ; RPS6KA1-010; intron 8
OTTHUMT00000390851 ; RPS6KA1-009; intron 8
OTTHUMT00000011432 ; RPS6KA1-002; intron 8
OTTHUMT00000011431 ; RPS6KA1-001; intron 8
OTTHUMT00000390850 ; RPS6KA1-010; intron 8
OTTHUMT00000390851 ; RPS6KA1-009; intron 8
OTTHUMT00000011432 ; RPS6KA1-002; intron 8
OTTHUMT00000011431 ; RPS6KA1-001; intron 8
OTTHUMT00000390850 ; RPS6KA1-010; intron 8
OTTHUMT00000390851 ; RPS6KA1-009; intron 8
OTTHUMT00000011432 ; RPS6KA1-002; intron 8
ENST00000530003 ; RPS6KA1-003; intron 7
ENST00000531113 ; RPS6KA1-011; intron 7
ENST00000531382 ; RPS6KA1-008; intron 7
ENST00000374162 ; RPS6KA1-201; intron 7
ENST00000374164 ; RPS6KA1-202; intron 7
ENST00000530003 ; RPS6KA1-003; intron 7
ENST00000531113 ; RPS6KA1-011; intron 7
ENST00000531382 ; RPS6KA1-008; intron 7
ENST00000374162 ; RPS6KA1-201; intron 7
ENST00000374164 ; RPS6KA1-202; intron 7
ENST00000530003 ; RPS6KA1-003; intron 7
ENST00000531113 ; RPS6KA1-011; intron 7
ENST00000531382 ; RPS6KA1-008; intron 7
ENST00000374162 ; RPS6KA1-201; intron 7
ENST00000374168 ; RPS6KA1-001; intron 8
ENST00000374166 ; RPS6KA1-010; intron 8
ENST00000526792 ; RPS6KA1-009; intron 8
ENST00000374163 ; RPS6KA1-002; intron 8
ENST00000374168 ; RPS6KA1-001; intron 8
ENST00000374166 ; RPS6KA1-010; intron 8
ENST00000526792 ; RPS6KA1-009; intron 8
ENST00000374163 ; RPS6KA1-002; intron 8
ENST00000374168 ; RPS6KA1-001; intron 8
ENST00000374166 ; RPS6KA1-010; intron 8
ENST00000526792 ; RPS6KA1-009; intron 8
ENST00000374163 ; RPS6KA1-002; intron 8
Database links

Mature sequence hsa-miR-1976

Accession MIMAT0009451
Sequence

33 -  

ccuccugcccuccuugcugu

 - 52

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18923441 "Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia" Schotte D, Chau JC, Sylvester G, Liu G, Chen C, van der Velden VH, Broekhuis MJ, Peters TC, Pieters R, den Boer ML Leukemia. 23:313-322(2009).