Dead miRNA entry

miRNA accession:
MI0009984
miRNA ID:
hsa-mir-1974
Comment:
mir-1974 maps to the Mt genome, and overlaps a Mt tRNA sequence so is removed.

Previous miRNA entry

Stem-loop sequence hsa-mir-1974

AccessionMI0009984 (change log)
Symbol HGNC:MIR1974~withdrawn
DescriptionHomo sapiens miR-1974 stem-loop
Stem-loop
             guu  aa      g    uuuu   ua 
5' uguucuugua   ga  uacaac augg    uca  u
   ||||||||||   ||  |||||| ||||    |||   
3' auaagagcgu   cu  auguug ugcu    ggu  c
             -gc  -g      g    ----   ua 
Get sequence
Deep sequencing
317736 reads, 814 reads per million, 159 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-1974

Accession MIMAT0009449
Sequence

48 - 

gugguuguaguccgugcgagaau

 - 70

Get sequence
Deep sequencing166006 reads, 158 experiments
Evidence experimental;