Stem-loop sequence sly-MIR172b

AccessionMI0009977 (change log)
DescriptionSolanum lycopersicum miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

28 open access papers mention sly-MIR172b
(125 sentences)

Stem-loop
                       a   -a     auuaag     a     aau     gcuuua    gaa 
5' auguagcaucaucaagauuc uac  ugaaa      aggca gguua   augua      auuu   a
   |||||||||||||||||||| |||  |||||      ||||| |||||   |||||      ||||    
3' uacgucguaguaguucuaag gug  acuuu      ucugu ccagu   uauau      uaaa   u
                       a   aa     -auuua     a     -ac     --aaua    aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named MIR172c in [1].

Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr11: 54397709-54397843 [+]
intergenic
Database links

Mature sequence sly-miR172b

Accession MIMAT0009144
Sequence

115 - 

agaaucuugaugaugcugcau

 - 135

Get sequence
Evidence by similarity; MI0002292

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).