Stem-loop sequence sly-MIR172a

Accession

MI0009976

Description

Solanum lycopersicum miR172a stem-loop

Gene family

MIPF0000035; MIR172

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

   ug    a          a     aaa   g    --- ug     a     g 
aug  gcau aucaagauuc cguga   guu caaa   u  guuau uaauu a
|||  |||| |||||||||| |||||   ||| ||||   |  ||||| ||||| u
uac  cgua uaguucuaag gcacu   caa guuu   g  cggua auuaa g
   gu    g          a     ---   a    auc gu     -     a 

Genome context

• Coordinates (SL2.40): SL2.40ch06: 42918736-42918841 [+]
• Overlapping transcripts:

  intergenic

Mature sequence sly-miR172a

• Accession: MIMAT0009143
• Sequence: 86 - agaaucuugaugaugcugcau - 106
• Evidence: by similarity; MI0001503

References

1. PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).