Stem-loop sequence sly-MIR162

AccessionMI0009975 (change log)
DescriptionSolanum lycopersicum miR162 stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

9 open access papers mention sly-MIR162
(18 sentences)

Stem-loop
   ca   g    c   acc       c     cuggaa    -   auauau 
5'   gga gcag ggu   auugauc guucc      gcug aau      a
     ||| |||| |||   ||||||| |||||      |||| |||      u
3'   ccu cguc cca   uagcugg uaagg      cgac uua      a
   ga   a    u   -aa       c     --aaaa    a   caacgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sly-miR162

Accession MIMAT0009142
Sequence

79 - 

ucgauaaaccucugcauccag

 - 99

Get sequence
Evidence by similarity; MI0005644

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).