Stem-loop sequence sly-MIR159

AccessionMI0009974 (change log)
DescriptionSolanum lycopersicum miR159 stem-loop
Gene family MIPF0000010; MIR159
Literature search

21 open access papers mention sly-MIR159
(152 sentences)

Stem-loop
              ga       c   aa   u    ---   u    u     g     c    g uu   c  c        uu    auu 
5' uggagcuccuu  aguccaa aaa  auc aaca   ggu aaau gagcu cugac uaug a  ccu ag ccuaucua  uaug   u
   |||||||||||  ||||||| |||  ||| ||||   ||| |||| ||||| ||||| |||| |  ||| || ||||||||  ||||    
3' aucucgaggga  uuagguu uuu  uag uugu   cca uuua uucga gacug auac u  ggg uu ggauagau  auac   c
              ag       u   ac   u    uuc   u    u     g     u    g uu   u  u        --    aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sly-miR159

Accession MIMAT0009141
Sequence

157 - 

uuuggauugaagggagcucua

 - 177

Get sequence
Evidence by similarity; MI0006495

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).