Stem-loop sequence sly-MIR156c

AccessionMI0009973
DescriptionSolanum lycopersicum miR156c stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u          ua           -uaac       uaauu 
5'  ugacagaaga  gagagcacgaa     gaggugc     g
    ||||||||||  |||||||||||     |||||||      
3'  acuguuuucu  cucucguguuu     uuccacg     g
   u          ua           cuuaa       uacaa 
Get sequence
Deep sequencing
7998 reads, 5.07e+03 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named MIR157c in [1].

Mature sequence sly-miR156c

Accession MIMAT0009140
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Deep sequencing4848 reads, 3 experiments
Evidence by similarity; MI0001771

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).