Stem-loop sequence sly-MIR156b

AccessionMI0009972 (change log)
DescriptionSolanum lycopersicum miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

32 open access papers mention sly-MIR156b
(157 sentences)

Stem-loop
   u         -       g     au   -       uaauu 
5'  ugacagaag auagaga cacga  aau gaggugc     g
    ||||||||| ||||||| |||||  ||| |||||||      
3'  acugucuuc uaucucu guguu  uua uuccacg     g
   u         a       a     cc   a       ucgaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named MIR157b in [1].

Database links

Mature sequence sly-miR156b

Accession MIMAT0009139
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence by similarity; MI0001771

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).