Stem-loop sequence sly-MIR156a

AccessionMI0009971 (change log)
DescriptionSolanum lycopersicum miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

33 open access papers mention sly-MIR156a
(175 sentences)

Stem-loop
   u         -           u     --   u     aauuuca   a 
5'  ugacagaag auagagagcac aauga  uga augcu       uuc a
    ||||||||| ||||||||||| |||||  ||| |||||       ||| u
3'  acugucuuc uaucucucgug uuacu  acu uacga       ggg u
   u         g           u     ua   c     aaacgac   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named MIR157a in [1].

Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 42851776-42851875 [-]
intergenic
Database links

Mature sequence sly-miR156a

Accession MIMAT0009138
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence by similarity; MI0005642

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).