Stem-loop sequence mmu-mir-1946b

AccessionMI0009967 (change log)
Symbol MGI:Mir1946b
DescriptionMus musculus miR-1946b stem-loop
Stem-loop
   --               c             --a      -----agag  aa  -      ua   g c 
5'   gggauuaaaggcgug gccaccacugccc   gcuuuc         ug  uu ugaggc  ucu g u
     ||||||||||||||| |||||||||||||   ||||||         ||  || ||||||  ||| | a
3'   cccuaauuuucguac cgguggugacggg   ugaaag         au  ga acuucg  aga u u
   ga               a             ccg      gggaaaaga  gg  c      uc   g a 
Get sequence
Deep sequencing
2407 reads, 764 reads per million, 123 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 21613444-21613576 [-]
intergenic
Database links

Mature sequence mmu-miR-1946b

Accession MIMAT0009443
Sequence

100 - 

gccgggcagugguggcacaugcuuuu

 - 125

Get sequence
Deep sequencing1936 reads, 73 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).