Stem-loop sequence mmu-mir-1960

AccessionMI0009957 (change log)
Symbol MGI:Mir1960
DescriptionMus musculus miR-1960 stem-loop
Literature search

1 open access papers mention mmu-mir-1960
(2 sentences)

Stem-loop
        u   c  c         u           gagag 
5' cagag gag ag cagugcugu agaagagggcu     c
   ||||| ||| || ||||||||| |||||||||||      
3' gucuc cuu uc gucacgacg ucuucucucga     a
        -   u  a         -           gaggg 
Get sequence
Deep sequencing
1602 reads, 132 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 30170739-30170816 [+]
sense
OTTMUST00000060920 ; Hadhb-001; intron 6
OTTMUST00000061035 ; Hadhb-002; intron 6
OTTMUST00000061036 ; Hadhb-003; intron 6
OTTMUST00000061038 ; Hadhb-005; intron 6
ENSMUST00000114783 ; Hadhb-003; intron 6
ENSMUST00000114786 ; Hadhb-002; intron 6
ENSMUST00000123980 ; Hadhb-005; intron 6
ENSMUST00000026841 ; Hadhb-001; intron 6
Database links

Mature sequence mmu-miR-1960

Accession MIMAT0009433
Sequence

13 - 

ccagugcuguuagaagagggcu

 - 34

Get sequence
Deep sequencing1536 reads, 67 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).