Stem-loop sequence mmu-mir-669n

AccessionMI0009951 (change log)
Symbol MGI:Mir669n
DescriptionMus musculus miR-669n stem-loop
Literature search

11 open access papers mention mmu-mir-669n
(19 sentences)

Stem-loop
        u  -    u     ug    ua 
5' uacau ug ugug ggaug  ugug  a
   ||||| || |||| |||||  ||||   
3' gugua ac acac ccuac  guau  a
        c  g    -     gu    gu 
Get sequence
Deep sequencing
1162 reads, 9.64 reads per million, 83 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 115979902-115979955 [+]
antisense
ENSMUST00000067485 ; Slc30a7-201; intron 7
Database links

Mature sequence mmu-miR-669n

Accession MIMAT0009427
Sequence

4 - 

auuuguguguggaugugugu

 - 23

Get sequence
Deep sequencing873 reads, 76 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).