![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-1955 |
|||||
Accession | MI0009950 (change log) | ||||
Symbol | MGI:Mir1955 | ||||
Description | Mus musculus miR-1955 stem-loop | ||||
Stem-loop |
-- -guuu u a g c ag uu ua 5' cug acu acuaca gucccag augca ugc cuu ucu a ||| ||| |||||| ||||||| ||||| ||| ||| ||| c 3' gau ugg ugaugu caggguc uacgu acg gaa aga u ac aaauu u a g u -a -u cu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-1955-5p |
|
Accession | MIMAT0009426 |
Previous IDs | mmu-miR-1955 |
Sequence |
18 - agucccaggaugcacugcagcuuuu - 42 |
Deep sequencing | 438 reads, 58 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-1955-3p |
|
Accession | MIMAT0017348 |
Sequence |
59 - gagcauugcaugcugggacau - 79 |
Deep sequencing | 144 reads, 50 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18849523
"In-depth characterization of the microRNA transcriptome in a leukemia progression model"
Genome Res. 18:1787-1797(2008).
|
2 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|