Stem-loop sequence mmu-mir-1955

Accession

MI0009950 (change log)

Symbol

MGI:Mir1955

Description

Mus musculus miR-1955 stem-loop

Literature search

2 open access papers mention mmu-mir-1955
(2 sentences)

Stem-loop

   --   -guuu   u      a       g     c   ag   uu   ua 
5'   cug     acu acuaca gucccag augca ugc  cuu  ucu  a
     |||     ||| |||||| ||||||| ||||| |||  |||  |||  c
3'   gau     ugg ugaugu caggguc uacgu acg  gaa  aga  u
   ac   aaauu   u      a       g     u   -a   -u   cu 

Deep sequencing

738 reads, 3.66 reads per million, 82 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr2: 92191977-92192074 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000088002 ; Phf21a-008; intron 1

  OTTMUST00000088005 ; Phf21a-011; intron 1

  OTTMUST00000088006 ; Phf21a-012; intron 1

  OTTMUST00000088007 ; Phf21a-013; intron 1

  OTTMUST00000034055 ; Phf21a-001; intron 1

  OTTMUST00000034057 ; Phf21a-003; intron 1

  OTTMUST00000034085 ; Phf21a-004; intron 1

  OTTMUST00000034056 ; Phf21a-002; intron 2

  OTTMUST00000034086 ; Phf21a-005; intron 2

  OTTMUST00000034088 ; Phf21a-007; intron 2

  OTTMUST00000034087 ; Phf21a-006; intron 3

  ENSMUST00000111294 ; Phf21a-004; intron 1

  ENSMUST00000111293 ; Phf21a-001; intron 1

  ENSMUST00000162146 ; Phf21a-013; intron 1

  ENSMUST00000111292 ; Phf21a-003; intron 1

  ENSMUST00000160235 ; Phf21a-008; intron 1

  ENSMUST00000162497 ; Phf21a-011; intron 1

  ENSMUST00000162188 ; Phf21a-012; intron 1

  ENSMUST00000044036 ; Phf21a-201; intron 1

  ENSMUST00000111290 ; Phf21a-204; intron 1

  ENSMUST00000111297 ; Phf21a-205; intron 1

  ENSMUST00000068702 ; Phf21a-202; intron 1

  ENSMUST00000142528 ; Phf21a-005; intron 2

  ENSMUST00000111291 ; Phf21a-002; intron 2

  ENSMUST00000138995 ; Phf21a-007; intron 2

  ENSMUST00000128781 ; Phf21a-006; intron 3

Database links

• EntrezGene:Mir1955
• MGI:Mir1955
• RNAcentral:URS000075BFA7_10090
• miRBase Tracker:MI0009950

Mature sequence mmu-miR-1955-5p

• Accession: MIMAT0009426
• Previous IDs: mmu-miR-1955
• Sequence: 18 - agucccaggaugcacugcagcuuuu - 42
• Deep sequencing: 530 reads, 76 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS000012FB25_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-1955-5p
  • miRDB:mmu-miR-1955-5p
  • microrna.org:mmu-miR-1955-5p

Mature sequence mmu-miR-1955-3p

• Accession: MIMAT0017348
• Sequence: 59 - gagcauugcaugcugggacau - 79
• Deep sequencing: 204 reads, 67 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS000016D613_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-1955-3p
  • miRDB:mmu-miR-1955-3p

References

1. PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).