Stem-loop sequence mmu-mir-1955

AccessionMI0009950 (change log)
Symbol MGI:Mir1955
DescriptionMus musculus miR-1955 stem-loop
Stem-loop
   --   -guuu   u      a       g     c   ag   uu   ua 
5'   cug     acu acuaca gucccag augca ugc  cuu  ucu  a
     |||     ||| |||||| ||||||| ||||| |||  |||  |||  c
3'   gau     ugg ugaugu caggguc uacgu acg  gaa  aga  u
   ac   aaauu   u      a       g     u   -a   -u   cu 
Get sequence
Deep sequencing
584 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 92191977-92192074 [+]
sense
OTTMUST00000088002 ; Phf21a-008; intron 1
OTTMUST00000088005 ; Phf21a-011; intron 1
OTTMUST00000088006 ; Phf21a-012; intron 1
OTTMUST00000088007 ; Phf21a-013; intron 1
OTTMUST00000034055 ; Phf21a-001; intron 1
OTTMUST00000034057 ; Phf21a-003; intron 1
OTTMUST00000034085 ; Phf21a-004; intron 1
OTTMUST00000034056 ; Phf21a-002; intron 2
OTTMUST00000034086 ; Phf21a-005; intron 2
OTTMUST00000034088 ; Phf21a-007; intron 2
OTTMUST00000034087 ; Phf21a-006; intron 3
ENSMUST00000111294 ; Phf21a-004; intron 1
ENSMUST00000111293 ; Phf21a-001; intron 1
ENSMUST00000162146 ; Phf21a-013; intron 1
ENSMUST00000111292 ; Phf21a-003; intron 1
ENSMUST00000160235 ; Phf21a-008; intron 1
ENSMUST00000162497 ; Phf21a-011; intron 1
ENSMUST00000162188 ; Phf21a-012; intron 1
ENSMUST00000044036 ; Phf21a-201; intron 1
ENSMUST00000111290 ; Phf21a-204; intron 1
ENSMUST00000111297 ; Phf21a-205; intron 1
ENSMUST00000068702 ; Phf21a-202; intron 1
ENSMUST00000142528 ; Phf21a-005; intron 2
ENSMUST00000111291 ; Phf21a-002; intron 2
ENSMUST00000138995 ; Phf21a-007; intron 2
ENSMUST00000128781 ; Phf21a-006; intron 3
Database links

Mature sequence mmu-miR-1955-5p

Accession MIMAT0009426
Previous IDsmmu-miR-1955
Sequence

18 - 

agucccaggaugcacugcagcuuuu

 - 42

Get sequence
Deep sequencing438 reads, 58 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-1955-3p

Accession MIMAT0017348
Sequence

59 - 

gagcauugcaugcugggacau

 - 79

Get sequence
Deep sequencing144 reads, 50 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).