Stem-loop sequence mmu-mir-669o

AccessionMI0009945 (change log)
Symbol MGI:Mir669o
DescriptionMus musculus miR-669o stem-loop
Gene family MIPF0000316; mir-467
Literature search

12 open access papers mention mmu-mir-669o
(16 sentences)

Stem-loop
   -  ca     a     g    gu        c     u        au 
5'  ug  ugugc ugugu uaua  ugugugug auguu augugugu  u
    ||  ||||| ||||| ||||  |||||||| ||||| ||||||||   
3'  ac  acacg acaca auau  acacacac uacaa uacauaua  u
   c  ac     a     a    gc        a     -        ag 
Get sequence
Deep sequencing
142325 reads, 359 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10514300-10514395 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669o
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
mmu-mir-297a-3chr2: 10515820-10515921 [+]
mmu-mir-466lchr2: 10516097-10516217 [+]
mmu-mir-297a-4chr2: 10517067-10517164 [+]
mmu-mir-669ichr2: 10517604-10517730 [+]
mmu-mir-669hchr2: 10518155-10518279 [+]
Database links

Mature sequence mmu-miR-669o-5p

Accession MIMAT0009421
Previous IDsmmu-miR-669o
Sequence

19 - 

uaguugugugugcauguuuaugu

 - 41

Get sequence
Deep sequencing123069 reads, 102 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-669o-3p

Accession MIMAT0017347
Sequence

56 - 

acauaacauacacacacacguau

 - 78

Get sequence
Deep sequencing19014 reads, 101 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).