Stem-loop sequence mmu-mir-669l

AccessionMI0009942 (change log)
Symbol MGI:Mir669l
DescriptionMus musculus miR-669l stem-loop
Gene family MIPF0000316; mir-467
Literature search

8 open access papers mention mmu-mir-669l
(11 sentences)

Stem-loop
   --    --   c     c     gu  u     c              au 
5'   guuu  gug augug guaua  ug gugug auguauaugugugu  a
     ||||  ||| ||||| |||||  || ||||| ||||||||||||||   
3'   caag  uac uacgc cauau  ac cacac uacauauacauaua  u
   ca    ua   u     a     au  c     a              ag 
Get sequence
Deep sequencing
124025 reads, 297 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10468971-10469068 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669l
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
Database links

Mature sequence mmu-miR-669l-5p

Accession MIMAT0009418
Previous IDsmmu-miR-669l
Sequence

19 - 

aguugugugugcauguauaugu

 - 40

Get sequence
Deep sequencing122552 reads, 102 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

Mature sequence mmu-miR-669l-3p

Accession MIMAT0017345
Previous IDsmmu-miR-669l*
Sequence

57 - 

auauacauacacacccauauau

 - 78

Get sequence
Deep sequencing1380 reads, 76 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:18923076 "Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs" Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R Genes Dev. 22:2773-2785(2008).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).