Dead miRNA entry

miRNA accession:
MI0009929
miRNA ID:
mmu-mir-1940
Comment:
The sequence reported as miR-1940 appears to be a fragment of the snoRNA SCARNA4. The pattern of reads mapping to the locus is also not consistent with microRNA processing (Kozomara and Griffiths-Jones, NAR 2014 42:D68-D73). The entry is removed from miRBase 21.

Previous miRNA entry

Stem-loop sequence mmu-mir-1940

AccessionMI0009929 (change log)
Symbol MGI:Mir1940
DescriptionMus musculus miR-1940 stem-loop
Stem-loop
   -a   a  aug      ---   -a      a  g  aa      --     u ug 
5'   gcc gg   cagccu   gcu  uggagg cu ag  ggugga  gcagu c  u
     ||| ||   ||||||   |||  |||||| || ||  ||||||  ||||| |   
3'   cgg cc   gucggg   uga  accucc ga uu  uuaccu  cgucg g  a
   ac   -  --g      aaa   ca      a  a  gg      uc     u cc 
Get sequence
Deep sequencing
685 reads, 7.02 reads per million, 57 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mmu-miR-1940

Accession MIMAT0009404
Sequence

20 - 

uauggaggacugagaagguggagcagu

 - 46

Get sequence
Deep sequencing659 reads, 54 experiments
Evidence experimental;
Predicted targets