Stem-loop sequence mmu-mir-1933

AccessionMI0009922 (change log)
Symbol MGI:Mir1933
DescriptionMus musculus miR-1933 stem-loop
Literature search

1 open access papers mention mmu-mir-1933
(1 sentences)

Stem-loop
   --   ug    cac       g  uuc      a   ugu   ca 
5'   ucc  aucc   agucaug ug   ggucuu guu   gac  g
     |||  ||||   ||||||| ||   |||||| |||   |||  u
3'   agg  uagg   ucagugu ac   ccagga caa   uug  u
   uc   gu    uua       g  -ua      c   --u   au 
Get sequence
Deep sequencing
663 reads, 0 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 21344588-21344675 [-]
sense
OTTMUST00000011700 ; Ugp2-001; intron 3
OTTMUST00000011701 ; Ugp2-002; intron 3
ENSMUST00000102875 ; Ugp2-001; intron 3
ENSMUST00000060895 ; Ugp2-002; intron 3
Database links

Mature sequence mmu-miR-1933-5p

Accession MIMAT0009396
Sequence

13 - 

agucaugguguucggucuuaguuu

 - 36

Get sequence
Deep sequencing135 reads, 43 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-1933-3p

Accession MIMAT0009397
Sequence

55 - 

ccaggaccaucagugugacuau

 - 76

Get sequence
Deep sequencing528 reads, 61 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).