Stem-loop sequence bta-mir-96

AccessionMI0009911 (change log)
DescriptionBos taurus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

7 open access papers mention bta-mir-96
(26 sentences)

Stem-loop
   ccacuac    -     gg  g cu        a      uu      ---   uc 
5'        cguc ugcuu  cc a  uuggcacu gcacau  uugcuu   gug  u
          |||| |||||  || |  |||||||| ||||||  ||||||   |||   
3'        guag acgaa  gg u  aaccguga cgugua  aacgag   cgc  c
   ------c    g     aa  g au        -      cu      ucu   cu 
Get sequence
Deep sequencing
936 reads, 109 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 94724422-94724524 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-96
bta-mir-183chr4: 94724660-94724729 [-]
bta-mir-96chr4: 94724422-94724524 [-]
bta-mir-182chr4: 94719929-94720039 [-]
Database links

Mature sequence bta-miR-96

Accession MIMAT0009388
Sequence

24 - 

uuuggcacuagcacauuuuugcu

 - 46

Get sequence
Deep sequencing933 reads, 74 experiments
Evidence by similarity; MI0000881
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).